Divya C R
Symptomatology and molecular diagnosis of banana streak virus disease. - Vellanikkara Department of Plant Pathology ,College of Horticulture 2011 - 55
The banana (Musa spp.) is a crop of global importance in terms of income
security to million of small farmers throughout the developing countries. It is the world's
fourth most important commodity after rice, wheat and corn and is produced in tropical
and subtropical regions. Banana is infected by several diseases caused by fungi, bacteria
and viruses. Among the viral diseases, Banana streak is now emerging as a major disease
affecting banana production world wide. This disease assumes significance as it affects
plant growth, fruit yield and quality. It is also causing problems to germplasm exchange
and in the certification of in vitro plantlets for international trade.
The present project was undertaken to study the symptomatology of Banana streak
disease, to investigate the role of root mealy bug - Geococcus sp. in the transmission of
Banana streak virus, to standardize molecular indexing of planting materials of banana
and to identify the source of resistance in the field gene bank.
The symptoms of the disease appeared on different parts of the plant such as leaf
lamina, midrib, pseudo stem and in bunches. On the leaf lamina, the symptoms developed
as discontinuous or continuous linear small chlorotic streaks. These chlorotic streaks later
turned necrotic, blackened and running perpendicular to the leaf axis extending from
midrib to the leaf margin or sometimes form a linear mosaic like pattern on the lamina
especially on older leaves. Dark brown coloured linear lesions appeared on other parts
like petiole, midrib, pseudo stem, and on bunches. Under severe conditions, necrosis and
death of cigar leaf was noticed. The plants showing such symptoms did not flower and
resulted in 100 percent yield loss. The impact of the disease on biometric and yield
characters was studied and observed that the disease affected the growth and yield of
banana. A significant correlation was observed between the expression of symptoms with
rainfall and temperature. The expression of the symptoms was more in cooler months and
less in summer.
The field gene bank comprising 290 accessions maintained at BRS, Kannara was
screened to assess the reaction of these accessions to the disease. The disease incidence
was recorded on seven accessions viz., Mottapoovan (AAB), Mysorepoovan (AAB),
Kalibale (AAB), Chandrabale (AAB) , Chinali (AAB), Nendran (AAB) and FHIA-3
(AAAB). The percent disease incidence ranged from13.25 to 32.16 .
The transmission studies proved that BSV was not transmitted mechanically or
through infected soil. The insect vectors of BSV were proved to be two species of mealy
bugs such as Dysmicoccus brevi pes (Cockerell) and Ferrisia virgata (Cockerell). The
studies on virus vector relationship of these mealy bugs showed that the maximum
acquisition feeding period, pre-acquisition fasting period, inoculation access period
required for successful transmission were three days, one hours and seven hours
respectively. The nymphs were more efficient vectors than adults. A minimum of thirty
numbers were required for successful transmission of BSV. Plants inoculated with
Dysmicoccus brevi pes (Cockerell) produced symptoms four weeks after inoculation and
in the case of Ferrisia virgata (Cockerell), it was six weeks.
Recently, the root mealy bug - Geococcus sp. is becoming a serious pest in banana
orchards of Kerala. Hence studies were conducted to investigate whether this mealy bug
has any role in the transmission of BSV. It was found that Geococcus sp. could not
transmit BSV. The banana aphid - Pentalonia nigronervosa Coquerel,the vector of
Banana bunchy top disease had no role in the transmission of the virus. The studies on
the transmission of the BSV through planting material proved that BSV is naturally
transmitted through the planting materials of banana.
PCR based molecular diagnosis is one of the reliable and quick method for the
virus indexing of planting materials. The molecular diagnosis of BSV using polymerase
chain reaction from infected samples was standardized using specific primers, (BSV
5466 5'AGAGTGGGTTTCATCAAGTAGC and BSV 6196-5'
GAA TTTCCCGCTCGCA T AAG) at an annealing temperature of 59° C. Immunocapture
polymerase chain reaction (lC-PCR) of BSV infected samples was also standardized
using the antiserum of BSV. By IC-PCR, the detection of episomal virus infection could
be done directly from the crude sap, avoiding the step of DNA isolation.
The outcome of this study will facilitate early detection and elimination of BSV
infected plants and ensure distribution of healthy planting materials both suckers and
tissue culture plants to the farmers of Kerala. Thereby, increasing the production as well
as the productivity of banana in the state.
632.3 / DIV/SY
Symptomatology and molecular diagnosis of banana streak virus disease. - Vellanikkara Department of Plant Pathology ,College of Horticulture 2011 - 55
The banana (Musa spp.) is a crop of global importance in terms of income
security to million of small farmers throughout the developing countries. It is the world's
fourth most important commodity after rice, wheat and corn and is produced in tropical
and subtropical regions. Banana is infected by several diseases caused by fungi, bacteria
and viruses. Among the viral diseases, Banana streak is now emerging as a major disease
affecting banana production world wide. This disease assumes significance as it affects
plant growth, fruit yield and quality. It is also causing problems to germplasm exchange
and in the certification of in vitro plantlets for international trade.
The present project was undertaken to study the symptomatology of Banana streak
disease, to investigate the role of root mealy bug - Geococcus sp. in the transmission of
Banana streak virus, to standardize molecular indexing of planting materials of banana
and to identify the source of resistance in the field gene bank.
The symptoms of the disease appeared on different parts of the plant such as leaf
lamina, midrib, pseudo stem and in bunches. On the leaf lamina, the symptoms developed
as discontinuous or continuous linear small chlorotic streaks. These chlorotic streaks later
turned necrotic, blackened and running perpendicular to the leaf axis extending from
midrib to the leaf margin or sometimes form a linear mosaic like pattern on the lamina
especially on older leaves. Dark brown coloured linear lesions appeared on other parts
like petiole, midrib, pseudo stem, and on bunches. Under severe conditions, necrosis and
death of cigar leaf was noticed. The plants showing such symptoms did not flower and
resulted in 100 percent yield loss. The impact of the disease on biometric and yield
characters was studied and observed that the disease affected the growth and yield of
banana. A significant correlation was observed between the expression of symptoms with
rainfall and temperature. The expression of the symptoms was more in cooler months and
less in summer.
The field gene bank comprising 290 accessions maintained at BRS, Kannara was
screened to assess the reaction of these accessions to the disease. The disease incidence
was recorded on seven accessions viz., Mottapoovan (AAB), Mysorepoovan (AAB),
Kalibale (AAB), Chandrabale (AAB) , Chinali (AAB), Nendran (AAB) and FHIA-3
(AAAB). The percent disease incidence ranged from13.25 to 32.16 .
The transmission studies proved that BSV was not transmitted mechanically or
through infected soil. The insect vectors of BSV were proved to be two species of mealy
bugs such as Dysmicoccus brevi pes (Cockerell) and Ferrisia virgata (Cockerell). The
studies on virus vector relationship of these mealy bugs showed that the maximum
acquisition feeding period, pre-acquisition fasting period, inoculation access period
required for successful transmission were three days, one hours and seven hours
respectively. The nymphs were more efficient vectors than adults. A minimum of thirty
numbers were required for successful transmission of BSV. Plants inoculated with
Dysmicoccus brevi pes (Cockerell) produced symptoms four weeks after inoculation and
in the case of Ferrisia virgata (Cockerell), it was six weeks.
Recently, the root mealy bug - Geococcus sp. is becoming a serious pest in banana
orchards of Kerala. Hence studies were conducted to investigate whether this mealy bug
has any role in the transmission of BSV. It was found that Geococcus sp. could not
transmit BSV. The banana aphid - Pentalonia nigronervosa Coquerel,the vector of
Banana bunchy top disease had no role in the transmission of the virus. The studies on
the transmission of the BSV through planting material proved that BSV is naturally
transmitted through the planting materials of banana.
PCR based molecular diagnosis is one of the reliable and quick method for the
virus indexing of planting materials. The molecular diagnosis of BSV using polymerase
chain reaction from infected samples was standardized using specific primers, (BSV
5466 5'AGAGTGGGTTTCATCAAGTAGC and BSV 6196-5'
GAA TTTCCCGCTCGCA T AAG) at an annealing temperature of 59° C. Immunocapture
polymerase chain reaction (lC-PCR) of BSV infected samples was also standardized
using the antiserum of BSV. By IC-PCR, the detection of episomal virus infection could
be done directly from the crude sap, avoiding the step of DNA isolation.
The outcome of this study will facilitate early detection and elimination of BSV
infected plants and ensure distribution of healthy planting materials both suckers and
tissue culture plants to the farmers of Kerala. Thereby, increasing the production as well
as the productivity of banana in the state.
632.3 / DIV/SY