MSc

ABSTRACT
The research entitled “Management of reniform nematode, Rotylenchulus reniformis Linford and Oliveira in vegetable cowpea using bacterial antagonists” was under taken in the Department of Nematology, College of Agriculture Vellayani, during 2018-2020. The objective was to isolate indigenous bacterial antagonists and to evaluate their biocontrol potential against R. reniformis in vegetable cowpea.
A random sampling was done during 2018-19 in the cowpea grown fields of Aryanad, Athiyannur, Balaramapuram, Kalliyoor, Madavoor, Nemom, Neyyattinkara, Ottasekharamangalam, Ottoor, Vellanad, Vellayani and Venganoor areas of Thiruvananthapuram district. A total of sixty six soil and root samples were collected from rhizosphere of vegetable cowpea for isolation of indigenous bacterial antagonists against reniform nematode by serial dilution technique. The bacterial colonies having characters similar to Bacillus and Pseudomonas were made into pure culture by streak plate method.
Cell free extracts (CFE) of forty five bacterial isolates obtained from soil, root and egg masses of R. reniformis were screened for juvenile mortality against R. reniformis and isolates which showed more than 50 per cent juvenile mortality were selected for preliminary screening under in vitro condition. CFE of twenty bacterial isolates at 100% concentration showed 50.50 to 100.00 per cent juvenile mortality 24 hours after treatment (HAT). The morphological and cultural characteristics and colony forming units of the twenty isolates were studied. CFE of four isolates (Isolate 26, 28, 25 and 11) at lowest concentration (25%) showed 65.50 to 73.50 per cent mortality of R. reniformis juveniles at 24 HAT while at highest concentration (100%) it was 98.50 to 100.00 per cent.
The selected bacterial isolates were tested for effect on egg hatching and juvenile mortality of R. reniformis. Experiment was laid out in CRD with 100, 50, 33.3 and 25% concentration of four selected isolates, plain broth and sterile distilled water as treatments and four replications. Isolate 26, 28, 25 and 11 at 100% concentration
recorded 3.33, 8.96, 11.67, 8.12 per cent egg hatching respectively at 7 days after treatment which was significantly superior to plain broth (93.96) and sterile distilled (94.17). CFE of Isolate 26, 28, 25 and 11 at 100% recorded 100, 100, 98.5 and 99.5 per cent juvenile mortality respectively 24 HAT and it was statistically on par. CFE of Isolate 26 at 100% concentration recorded 95.50 per cent juvenile mortality at 12 HAT.
The four best isolates were tested for pathogenic reaction towards cowpea plant and none of them were pathogenic. Pot culture study was laid out in CRD to find out the biocontrol potential of the four isolates on R. reniformis in vegetable cowpea with five treatments and four replications. Effect of the four indigenous isolates were significantly superior to the untreated in reducing the nematode population in soil (87.35 to 91.45 per cent reduction over untreated) and number of egg masses in root (56.25 to 89.06 per cent reduction over untreated). The reproduction factor was also found reduced by the bacterial isolate application. The reproduction factor recorded by isolate 26, 28, 25 and 11 was 0.21, 0.27, 0.30 and 0.24 respectively while in control it was 2.41.
The molecular characterization was done for identification of the bacterial isolates. Internal transcribed regions of DNA of 16SrRNA of bacterial isolates were amplified by PCR using CAGGCCTAACACATGCAAGTC as forward primer and GGGCGGWGTGTACAAGGC as reverse primer. The blast search of amplified DNA in NCBI data revealed the identity of bacterial isolates. The Isolate 26, 28, 25 and 11 were identified as Lysinibacillus capsici strain NSK-KAU, Bacillus paramycoides strain NSK-KAU, Bacillus thuringiensis strain NSK-KAU, and Bacillus sp. strain NSK-KAU respectively.
L. capsici, B. paramycoides, B. thuringiensis and Bacillus sp. showed high egg hatch inhibition and juvenile mortality under in vitro condition and low reproduction factor and egg masses under in vivo condition. This was reported first time from Kerala. From this study, it could be concluded that these bacterial antagonists can be exploited as successful biocontrol agents for the management of reniform nematode in cowpea.