BSc - MSc (Int.)

The present research work entitled ‘Molecular characterization of Blackeye cowpea
mosaic virus causing mosaic disease in cowpea (Vigna unguiculata (L.)Walp) in Kerala’
was carried out in Department of Plant Biotechnology and Department of Plant Pathology,
College of Agriculture, Vellayani, during the year 2020-2021, with the objectives to clone
and sequence the coat protein gene of Blackeye Cowpea mosaic virus causing mosaic in
cowpea (Vigna unguiculata (L.)Walp.) in Kerala and to analyse its sequence.
Samples collected from five agro-ecological zones of the state namely Pappanchani,
Thiruvananthapuram (Coastal zone), Puthucode (Palakkad plain), Meenaghadi, Wayanad
(High hill zone), Vellanikkara, Thrissur (Midland plain) and Edayazham,
Kottayam(Foothill zone) showed severe mosaic patterns, dark green vein banding,
puckering of leaves and interveinal chlorosis. Plots were surveyed and infected leaves of
cowpea were collected. Highest disease incidence was recorded from Pappanchani
(Thiruvananthapuram) (55 per cent).
Primers of coat protein gene were designed based on the conserved sequences
reported from India using Primer3plus tool and the coherence was analysed using Oligo
and Primer Express software. The forward primer (TCAGGAACTGGGCAGCCGC) had a
length of 19bp whereas the reverse primer (CTCGATCCGATGTTTTGGATG) had a
length of 20 bp.
Quality and quantity of the RNA samples isolated from infected leaves were
analysed, which gave an absorbance value of 1.8 to 2.0. The concentrations of the samples
were between 2900-3400 ngµl-1
. cDNA amplified with designed coat protein specific
primers produced an amplicon of 670bp. Amplicon was eluted from the gel, ligated with
pMD20-T vector and cloned to competent E.coli DH5α. Transformants were screened
through blue white screening technique on LB ampicillin/X-GAL/IPTG plates wherein
recombinant transformed cells appeared as distinct white colonies. Colony PCR of the
transformed colonies that gave band in the expected size range were chosen for plasmid
95
isolation and sequencing. The resultant sequences from Thiruvananthapuram, Thrissur,
Kottayam, Wayanad, and Palakkad sample had a length of 674bp, 674bp, 673bp, 669bp
and 674bp respectively.
BLAST analysis of resultant sequences showed that Thiruvananthapuram (95 per
cent), Thrissur (97percent), Kottayam (96per cent), Wayanad (98per cent) and Palakkad
virus isolate (98per cent) had similarity with other reported Bean common mosaic virus
(BCMV) sequences. The sequences deposited in GenBank obtained accession numbers
such as OL343665, OL343666, OL343667, OL343668, OL343669 for virus isolate from
Thiruvananthapuram, Thrissur, Kottayam, Wayanad and Palakkad sample.
Phylogenetic tree constructed using resultant sequences, four reported sequences
from North India and two reported sequences from South India got categorised into two
clusters viz., North India and South India. The obtained sequences were classified under
the cluster of South India and subcluster of Kerala at 99 per cent similarity. Phylogenetic
tree constructed with only isolated sequences formed into two clusters at a similarity of 99
per cent.
To conclude, the result of the study indicates that the coat protein sequence of the
Blackeye cowpea mosaic virus, isolated from five agro-ecological zones of Kerala, had 99
per cent similarity to the reported sequences of BCMV.